(22/06/2024) עלו היום לאתר 9 סמינריונים 2 תזות 2 מאמרים

לרכישה גלול למטה לסוף הדוגמית

Dishevelled 2 recruits beta-arrestin 2 to mediate Wnt5A-stimulated endocytosis of Frizzled 4

חלבונים Wnt, ויסות התפתחות באורגניזמים רבים, נקשרים לשבעה קולטני טרנסמברנפרנס (7TMS) הנקראים frizzleds, ובכך מגייסים   את המולקולה הציטופלסמית מחולקת (Dvl) לקרום הפלזמה. אנדוציטוזיס מתווך של Wg (חלבון Wnt Drosophila) ונפילות ליזוזומליות עשויות לווסת את היווצרותם של שיפועי מורפוגן. אנדיקוזיס של Frizzled 4 (Fz4) בכליות עובריות אנושיות 293 תאים היו תלויות בחלבון Wnt5A נוסף והושלם על ידי חלבון מתאם רב-פונקציונלי -ארסטין 2 (arr2), שגויס ל- Fz4 על ידי קשירה ל- Dvl2 זרחתי. ממצאים אלה מספקים מנגנון שקודם לכן לא היה מוכר לקולט גיוס של -ארסטין והדגמה כי Dvl ממלא תפקיד חשוב באנדוציטוזה של פריזלד, כמו גם בייזום איתות.מולקולות האיתות הגליקופרוטאין המופרש של משפחת Wnt (ללא כנפיים או Wg בתסיסנית) נשמרים באבולוציה וממלאים תפקידים התפתחותיים חשובים (1). פעילות Wnt מתווכת על ידי אינטראקציה עם קולטנים של 7TMS מקופלים, שמאותתים על ידי ייצוב-קטנין, ובכך משפרים את פעילותם של גורמי העתקת  LEF / Tcf. אמצעי האיתות הפרוקסימלי ביותר במסלול זה הוא מולקולה ציטופלסמטית, Dvl, המגויסת לקרום הפלזמה מאת Fz (2, 3). בתסיסנית, Wg הוא endocytosed באופן פרזל-תלוי באופן, והגביל את המרחב ההבדל בשיעורי של endocytosis Wg ושפלות lysosomal מתואמים עם היווצרות של מדרגות Wg morfogen (4).

חלבוני Wnt,  הרגולטורים להתפתחות באורגניזמים רבים נקשרים לשבעה קולטנים המתפשטים (7TMS) העוסקים בטרנסממברנה, הנקראים פריזלזלים, ובכך מגייסים את המולקולה הציטופלסמית המפותלת (Dvl) לקרום הפלזמה. אנדוציטוזה מתווכת של Frigled של Wg (חלבון Wnt Drosophila) והשפלות ליזוזומלית עשויות לווסת את היווצרותם של שיפועי מורפוגן. אנדיקוזיס של Frizzled 4 (Fz4) בכליות עובריות של בני אדם 293 תאים היו תלויים בהוספה  של חלבון Wnt5A והושג על ידי החלבון המתאם הרב-תכליתי -ארסטין 2 (arr2) שגויס ל- Fz4 על ידי קשירה לפוספורילציה.

Dvl2. ממצאים אלה מספקים מנגנון שאינו מוכר בעבר לגיוס הקולטנים של -ארסטין ומראים כי Dvl ממלא תפקיד חשוב באנדוציטוזה של פרזל, כמו גם בקידום איתות.

מולקולות האיתות הגליקופרוטאין המופרש ממשפחת ה- Wnt (ללא כנפיים או Wg Drosophila) נשמרות בהתפתחות וממלאות תפקידים התפתחותיים חשובים (1).

פעילות ה- Wnt מתווכת על ידי אינטראקציה עם קולטני ה- 7TMS הקשים, שמאותתים על ידי ייצוב-קטנין, ובכך משפרת את פעילותם של גורמי התמלול LEF / Tcf.

אמצעי האיתות הפרוקסימלי ביותר במסלול זה היא מולקולה ציטופלסמית, Dvl, המגויסת לקרום הפלזמה .

ארסטינים הם חלבוני מתאם רב-פונקציונליים בכל מקום המווסתים באופן אוניברסלי היבטים רבים של תפקוד הקולטן 7TMS (5). כאשר קולטנים מופעלים, הם זורקים במהירות זרחתי על ידי קינאזות קולטנים מקושרים לחלבון G (GRKs) (6), ואז נקשרים -ארסטין 1 או 2. -ארסטינים מרגישים את דור המסר השני על ידי חסימת סטרואידים אינטראקציה של קולטן –G (5 ); לתווך אנדוציטוזיס של הקולטנים בבורות מצופים קלתרין על ידי קשירת קלתרין, AP-2, ואלמנטים אחרים של מכונות אנדוציטיות (7, 8); ומשמשים כפיגומים המקשרים בין הקולטנים למסלולי איתות אחרים (9-11). כאן חקרנו את המנגנונים האחראים להפנמת Fz ואת המעורבות האפשרית של -ארסטינים בתהליך זה.

כדי להמחיש קולטנים של Fz4 בתאים חיים, בנינו מולקולת חלבון פלואורסצנטי מסוג Fz4 ירוק (GFP) וביטאנו ב293 תאים עובריים  (HEK293) אנושיים (12). הוא היה נוכח בעיקר על פני התא (איור 1 א) עם כמה פונקטות ירוקות שנצפו גם בציטוזול, אולי בגלל נוכחות של Fz4-GFP מעובד חלקית.

כאשר גירוי התאים למשך 30 דקות עם מתווך Wnt5A (Wnt5A), שמפעיל איתות דרך Fz4 (13), לא נצפתה הפנמה של Fz4-GFP (איור 1 ב). באופן דומה, הפעלה של חלבון קינאז C (PKC) עם 1 M פורבול מוריסטו-אצטט (PMA) למשך 30 דקות לא הביאה להפנמת קולטן (איור 1 ג). עם זאת, כאשר התאים היו מגורים במקביל ל Wnt5A וגם להפעלת PKC כמו PMA (איור 1D) או חומר P, המפעיל קולטנים המשולבים לחלבון G G (איור 1E), הופנמה Fz4-GFP והקולטן היה בתוך שלפוחיות תאיות.

קולטן האב טיפוס 7TMS, הקולטן הדו-אדרנרגי (2-AR), מופנם על ידי מנגנון בור קלאסי-קלוירינקטורי המשמש ב- arestin כמתאם לקישור אלמנטים שונים במכונות האנדוציטיות (14). כדי להשוות את המנגנונים של הפנמת Fz4 ו- 2-AR, הבאנו ביטוי ל- Fz4 GFP וחלבון פלואורסצנטי 2-AR – אדום (15) באותו תאי HEK293 וגירינו אותם במשך 30 דקות עם, בו זמנית, Wnt5A (בנוכחות PMA) ואיזופרוטרנול שני הקולטנים הופנמו והופיעו באותה אוכלוסיה של שלפוחיות תוך תאיות (איור S1). יתר על כן, טיפול בתאים המבטאים Fz4-GFP עם מעכבי קלתרין סוכרוז (0.45 מ ‘) או מונודנסילקדאוורין (200 מ’) עיכבו את ההפנמה הנגרמת על ידי Wnt5A ו- PMA של Fz4 (16). ביחד, נתונים אלה מצביעים על כך שהפנמת Fz4 מתווכת על ידי תהליך clathrinmediated דומה לזה ששימש להפנמת ה- 2-AR. מכיוון ש- 2-AR ומספר קולטני 7TMS אחרים משתמשים ב-arrrestins כמתאמים חיוניים באנדוציטוזה בתיווך clathrin (14), בדקנו אם -ארסטינים היו מעורבים בהפנמת Fz4. השתמשנו ב- RNA מתערב קטן (siRNA) כדי להפחית את הביטוי של arr2 בתאי HEK293 (איור S2) (17). הפנמה של Fz4 הנגרמת על ידי Wnt5A ו- PMA בוטלה לחלוטין בתאים המבטאים arr2 siRNA (איור 1, F עד I). לעומת זאת, נפילה של arr1 לא השפיעה על ההפנמה של Fz4 (16).לאחר מכן בדקנו את ההשפעות של גירוי Fz4 על התפוצה המרחבית של arr2-GFP. כאשר arr2-GFP התבטא בתאי HEK293, הוא הופץ בצורה דיפוזית בציטופלזמה (איור 2 א). תפוצה זו לא הושפעה כאשר ה- Fz4 בא לידי ביטוי יחד עם arr2-GFP, אפילו כאשר התאים היו מעוררים באמצעות Wnt5A עד 12 שעות (איור 2B). מכיוון ש arr1 מקיים אינטראקציה עם Dvl (18), התבטאנו יחד ב- arr2-GFP יחד עם Dvl2, אך זה גם לא שינה את התפלגות arr2-GFP (איור 2 ג). עם זאת, ביטוי משותף של Fz4, Dvl2 ו- arr2-GFP הוביל להפצה מחדש של arr2 לקרום הפלזמה, שם הוא נמצא בתבנית פיסוק (איור 2, D ו- E). דפוס זה דומה לזה שנצפה בעבר עם 2-AR המגורה (19). חוסר היכולת שלנו לאתר גיוס arr2 ל- Fz4 בהיעדר transfection Dvl נובע ככל הנראה מכמויות לא מספיקות של Dvl אנדוגני לקיים אינטראקציה עם הכמויות הגדולות יותר של arr2-GFP הטרנספוקס. כאשר נעשה שימוש ב arr1-GFP ולא arr2-GFP, לא נצפתה שום גיוס ל- Fz4, אפילו לא בנוכחות Dvl2 (16). לפיכך, טרנסלוקציה arr2-GFP לקרום הפלזמה דרשה גם Dvl2 וגם Fz4. כאשר 50 או 200 ng של פלזמיד Fz4 התבטאו במשותף עם 200 ng של Dvl2 ופלסמיד arr2-GFP, 20% או 70% מהתאים המבטאים arr2-GFP הדגימו טרנסלוקציה arr2-GFP, בהתאמה (N 3). על בסיס ממצאים אלה, Fz4 עשוי להיות צפוי לגייס ישירות את Dvl2 לפלזמה קרום בלתי תלוי arr2. אכן, כאשר ה- Dvl2-GFP התבטא במשותף עם Fz4, הוא הופץ מחדש בצורה חלקה ושווה לקרום הפלזמה (איור S3B), ואילו הוא הופץ בצורה דיפוזית בכל הציטופלסמה כשהוא בא לידי ביטוי בלבד (איור S3A) (2, 13).

אינטראקציות בין Fz4, Dvl2 ו- arr2 נבדקו גם על ידי ניסויים שקיבלו את התרופה. כשהוא מתבטא בתאי HEK293, Fz4 תויג עם פלאג אפיטופ coimmunopopipitated עם Dvl2 שונה להכיל את הכינוי Myc (איור 2F). FLAG-arr2 הוחזר עם Myc-Dvl2 (איור 2G).  האינטראקציה של His-arr2 עם FLAG-Fz4 הוגברה כאשר ביטוי Myc-Dvl2 (איור 2H). אינטראקציה זו לא הוגברה עוד יותר על ידי גירוי של התאים באמצעות Wnt5A. נתונים אלה מצביעים על כך ש- Fz4 יכול לגייס ישירות את Dvl2, אך אולי לא arr2, לקרום הפלזמה וכי Dvl2 הוא זה שאחראי לגייס arr2 לממברנת הפלזמה כדי לקשור את Fz4.

זה מייצג מצב חדש של ויסות על ידי arr2, שבמקרים אחרים מגויס לקולטני 7TMS ישירות לאחר זרחן קולטן, ללא מעורבות של חלבוני מתאם אחרים (20).

בתאים המביעים Co-expressing FLAG-Fz4, MycDvl2 ו- arr2-GFP, קלתרין אנדוגני ו- arr2-GFP הופצו בתבנית פיסוק חופפת בקרום הפלזמה (איור 3, א עד ג). זה מרמז כי arr2, שגויס ל- Fz4 על ידי Dvl2, מסוגל למקד ל- Fz4 לבורות מצופים קלתרין להפנמה. כאשר תאים המבטאים Fz4, Dvl2 ו- arr2 היו מעוררים באמצעות Wnt5A למשך 30 דקות, אין שום גיוס ממברנה נוסף של arr2-GFP נצפתה (איור 3, D ו- E); עם זאת, Fz4-GFP הופנם והופיע בשלפוחיות תוך-תאיות (איור 3, F ו- G). וכך, כמו עם ה- 2-AR (19, 21), arr2 מתנתק מ- Fz4 ואינו מופנם איתו. לפחות כאשר Fz4, Dvl2 ו- arr2 כולם מתבטאים זה בזה, נראה כי הפעילות המכוננת של Fz4 מספיקה לקידום גיוס arr2 בתיווך Dvl2, אך לא הפנמת Fz4, הדורשת איתות נוסף לגירוי Wnt5A.

ממצאינו מראים כי הפנמת Fz4 מחייבת, בנוסף ל- Dvl2 ו- arr2, את פעילות ה- PKC וגם את נוכחותו של אגוניסט Wnt5A הקשור לקשקש. לפיכך, PKC עשויה להידרש פעילות להרכבת המתחם של Fz4, Dvl2 ו- arr2. בהתאם, בדקנו את ההשפעה של מעכב PKC על תופעות אלה. כאשר Fz4 ו- Dvl2-GFP התבטאו יחד, Dvl2-GFP נמצא בקרום הפלזמה עם Fz4. קשר זה לא הושפע מטיפול של שעה עם מעכב PKC GFX109203 (4 M) (איור 4, A ו- B). עם זאת, כאשר Fz4, Dvl2 ו- arr2-GFP התבטאו יחד בתאים, arr2-GFP נמצא בקרום הפלזמה (איור 4C), והקשר הזה שיבש על ידי מעכב PKC (איור 4 ד). לפיכך, פעילות PKC נחוצה לגיוס המתווך Dvl2 של arr2 ל- Fz4. הנתונים באיור 4, E עד G, תומכים עוד ברעיון ש- PKC מזרחן Dvl2 כדי להגדיל את האינטראקציות שלו עם arr2. איזו-פורמולים אנדוגניים של PKC, וקופוני-co-immunopitated עם Myc-Dvl2 (איור 4E), ותוספת של [-32P] ATP לחיסונים כאלו הובילו לפוספורילציה של Dvl2 על ידי קינאז (ים) אנדוגניים הקשורים ל- Dvl2, ככל הנראה כולל PKC (איור 4F) (22–24). יתר על כן, כפי שמוצג העברות ניידות ב- SDS–אלקטרופורזה בג’ל polyacrylamide, נראה כי ה- Dvl2 האנדוגני זורם לאחר גירוי PMA של תאים (איור 4G). לבסוף, PKC מטוהר Dvl2 מחוסן מחוסן בזרחן, וזה שיפר את קשירתו ל arr2 (איור 4F) תפקידו של Dvl2 – לגייס arr2 ובכך לקדם את ההפנמה של Fz4 – מחזק את תפקידו המרכזי של Dvl בתיאום הרגולציה של פעילות הקולטנים הקצוצים. הדרישה לגירוי Wnt5A במקביל והפעלת PKC להפנמת Fz4 מרמזת על מנגנון מורכב בו יתכן שיהיה צורך באיתותים מעבר לאלו הנובעים מגירוי Fz ישיר להפעלת אנדוציטוזיס Fz.

המטרה הסופית של הפנמה בתיווך arr2 של Fz4 נותרה לא ידועה ועשויה להתייחס להיווצרות שיפוע Wnt, איתות או ויסות קולטנים.

B-ארסטין 2 מתווך אנדוציטוזיס של קולטן TGF מסוג III וויסות הורדת האיתות שלו

-ארסטינים נקשרים לשבעה קולטני סריקה (7TMS) המופעלים (רצפטורים מצמידים חלבון G) לאחר הקולטנים זרחניים על ידי זרעי רצפטורים מצמידים חלבון G (GRK), ובכך מווסתים את האיתות וההפנמה שלהם. כאן אנו מדגימים תפקיד בלתי צפוי ואנלוגי של -ארסטין 2 (arr2) עבור טרנספורמנס יחיד – המשתנה מסוג III

גורם גדילה– (TGF-) קולטן (T RIII, המכונה גם betaglycan). קשירה של arr2 ל- T RIII הופעלה גם על ידי זרחן של הקולטן על התחום הציטופלזמתי שלו (ככל הנראה בטרונין 841).

הפוספורילציה תווכה על ידי הקולטן TGF מסוג II (T RII), שהוא עצמו קינאז, ולא על ידי GRK. שיוך עם arr2 הוביל להפנמה של שני הקולטנים ולוויסות למטה של איתות TGF. , הפעולות רגולטוריות של arestins רחבות ממה שהוערך בעבר, והן נמשכות גם למשפחת הקולטנים TGF.

משפחת הליגנדים המשנים את גורם הגידול (TGF-1, – 2, – 3) מווסתת תהליכים רב תאיים על ידי קשירה למתחמים הטרומריים של סוג I (T RI) בעל זיקה גבוהה , סוג II (T) RII), וסוג III (T RIII או betaglycan) קולטני TGF (1). לאחר קשירת ליגנד, T RII, פעיל סרינטרונין קינאז פעיל, מגייס ומזרחן T RI, ובכך מפעיל פעילות סרין-טריונין קינאז של T RI.

לאחר מכן, ה- T RI המופעל מגייס ומזרחן גורמי תעתיק של Smad, אשר מתרגמים לגרעין כדי לווסת את הגנים התגוביים ל- TGF.בעוד TBRII קושר רק TGF-1 ו- TGF-3 באופן עצמאי, T RIII קושר את כל שלושת ה- TGF- isoforms בעלי זיקה גבוהה, ובמיוחד במקרה של TGF-2, מציג ליגנד זה ל- TBRII (2). עם זאת, in vivo, הוכח כי TBRIII נדרש לא רק לאיתות TGF-2 (3), אלא גם לאיתות TGF-1 (4). מאפיין חשוב נוסף של קולטני TGF הוא שהם מופנמים באופן מכונן, והפנמה זו עשויה להיות בעלת תפקידים חשובים באיתות TGF.(5-8).

ארסטינים נקשרים לשבעה טרנסממברנות – הקולטנים המתפשטים (7TMS) לאחר הפוספורילציה

על ידי קינאזות הקולטנים של G- חלבון (GRKs) (9, 10). קשירת ארסטין משמשת לניתוק הקולטנים מחלבוני ה- G, לקישור פונקציונלי של הקולטנים למסלולי איתות אחרים, לרבות מפל החלבונים של המינוגן המופעל על ידי מיטוגן (9), וכדי לתווך את הפנמתם באמצעות בורות מצופים קלתרין (11).

חלבון פלואורסצנטי ירוק (GFP) – מתויגים -ארסטינים, כאשר הם מבוטאים לבד, מופצים בצורה דיפוזית לאורך הציטופלזמה (12). עם זאת, כאשר הם באים לידי ביטוי יחד עם קולטני 7TMS, גירוי אגוניסטי מביא למעבר שלהם לקרום הפלזמה, שם הם נשארים מקומיים עם הקולטנים או מופנמים במהירות עם הקולטנים ומתמחים איתם בתוך שלפוחית תוך תאית (12, 13). לחקור בין אם לארסטינים יש תפקיד בוויסות קולטני TGF- superfamily, אנו מתקיימים יחד….

  G   קולטנים משולבי חלבון קינאזים פוספורילט LRP6 בנתיב Wnt *

התקבל לפרסום, 22 ביולי, 2009 ובצורה מתוקנת, 14 בספטמבר, 2009 פורסם, JBC Papers in Press, 2 באוקטובר, 2009, DOI 10.1074 / jbc.M109.047456 מינינג חן ‡ 1, מלאני פיליפ§1,2, ג’יאנגבו וואנג, ריצ’רד ט. פרמונט, טיפאני ר. גארריסון, מרק ג. קארון, רוברט ג’יי לפקוביץ, 3, ווי צ’ן, 4 מהמחלקות לרפואה, ביולוגיה תאים ו- ¶ ביוכימיה והמכון הרפואי להווארד יוז, המרכז הרפואי של אוניברסיטת דיוק, דוראם, צפון קרוליינה 27710

ליגנדים Wnt מבצעים את תפקידיהם באיתות Wnt קנוני על ידי כריכה לשני קולטנים, הפרוטאינים הקשורים לקולטן ליפופרוטאין בצפיפות נמוכה יחידה 5 ו- 6 (LRP5 / 6) ושבעה קולטני טרנזמברה (7TM). לאחר מכן, זרחן של שאריות סרין / טרונין בתוך חמישה מוטיבי PPPSP מסומנים החוזרים על LRP6 אחראי להפעלת LRP6. GSK3, קינאז ציטוזולי לזרחן של אפקטור-קטנין במורד הזרם, לוקח חלק בזרחן LRP6 כזה. כאן אנו מדווחים על מחלקה חדשה של קינאזות הקשורות לקרום עבור זרחן LRP6. גילינו שקינאזז קולטנים משולב חלבון G 5 ו- 6 (GRK5 / 6), הידוע באופן מסורתי כזרחן ומזהה את הקולטנים המשולבים של חלבון 7TM G, מזרחים באופן ישיר את מוטיבי ה- PPPSP על LRP6 טרנסממברני יחיד ומווסתים אות Wnt / LRP6. הפעלת LRP6 הנגרמת על ידי GRK5 / 6 מעוכבת על ידי אנטגוניסט LRP6 דיקופף. ניוון GRK5 מקטין באופן ניכר את זרחן ה- LRP6 המעורר WN3A בתאים. בדגי-זברה, הפילה הפונקציונלית של GRK5 מביאה לאיתור Wnt מופחת, בדומה למפילה LRP6,

הוערך על ידי ירידה בשיעור של קטנין והופעת ביטוי של גני היעד Wnt cdx4, vent ו- axin2. ביטוי של GRK5 מציל את התגובה הקטנית-אקסינ 2 שנגרמה כתוצאה מדלדול GRK5. לפיכך, הממצאים שלנו מזהים את GRK5 / 6 כקינאזות חדישות עבור הקולטן הבודד LRP6 במהלך איתות Wnt מולקולות Wnt מופרשות ליגנדות איתות חוץ-תאי המשתמרות מתולעים לבני אדם, המסדירות את האורגנוגנזה ואת התחדשות הרקמות. על פני תאי המטרה, Wnts נקשרים ומפעילים ישירות שני קולטני ליבה מבניים שאינם קשורים: קולטני הטרנזמברנה הבודדים, חלבונים הקשורים לקולטנים ליפופרוטאין בצפיפות נמוכה 5 ו- 6 (LRP5 ו- LRP6) 5 ושבעה קולטני טרנסממברנה (7TM) ממשפחת Frizzled (1–4). שני הקולטנים פועלים בתיאום כדי לעכב את פעילות הקינאז של ציטוזולי גליקוגן סינטאז קינאז -3 (GSK3), מה שמוביל לייצוב של -קטנין בסיטוזול ומשפר את הפעילות הגרעינית של גורמי שעתוק LEF / TCF (5, 6). איתות לא תקין של Wnt / LRP5 / 6 נקשר לסוגים רבים של סרטן ומחלות התפתחות הקשורות לתאי גזע (7)

לאחר גירוי Wnt3A, LRP6 מופעל על ידי זרחן בטרמינוס C שלו. מקומות הפוספורילציה כוללים 1) טרונין 1479 הזרחתי על ידי המקזאין קינאז 1 (8) הקשורים לממברנה, ו -2) שאריות סרין / טרונין מרובות בתוך חמישה מוטיבים PPPSP מסומנים החוזרים על עצמם, אשר בדרך כלל מנוטרים על ידי זרחן של סרין 1490 ברצף ה- PPPSP הראשון. (9). הציטוזולי GSK3 הוצע להיות הקינאז האחראי לקולטן LRP6 הקשור לקרום-זרם (10, 11), אך נותר חידתי כיצד זורם כזה מתחיל על קרום הפלזמה.

קינאזות קולטן 5 ו -6 מקושרות לחלבון G (GRK5 ו- GRK6) הינן קינאזות חלבון לסרין / תראונין קינאזות, והן חולקות קווי דמיון ברצף ובפונקציות (12,13). שני הקינאזות הללו באים לידי ביטוי בכל מקום וקולטנים צמודי חלבון G זרחניים (GPCR) עם גירוי אגוניסט (12, 14). זרחן קולטני כזה גורם לתיאור רגישות, הפנמה ואיתות קולטנים בתיווך ארסטין (13). יותר ויותר נתונים הוכחו כי -ארסטינים הם מרכיב חשוב באיתות Wnt (15–17). לדוגמא, -arrestin2 יכול לתווך אנדוציטוזיס Frizzled 4 באמצעות גירוי Wnt5A באמצעות Dishevelled2 (17). עם זאת, אם GRKs יכולים להסדיר איתות Wnt אינו ידוע. כאן אנו מדווחים כי GRK5 ו- GRK6 מתפקדים כקינאזות רומן האחראיות על זרחן LRP6 באיתות Wnt.

נהלי ניסוי

פלסמידים, נוגדנים, וריאגנטים – pcDNA3 LRP6 (אנושי) סופק על ידי ד”ר ג’יי פרד הס (מרק, ווסט פוינט, פנסילווניה). כתב העת לוציפראז פלסמיד p8xTOP פלאש הושג מד”ר רנדל מון (אוניברסיטת וושינגטון). זנב ציטוזולי של LRP6 (LRP6-CT) וגנויו המוטנטים של M5 מבית הספר לרפואה מתקדמת של Duke-NUS, שונו ל pET30a (Stratagene) בכדי לבטא חלבון היתוך LRP6-CT His6 עם תאי חלבון ב- Escherichia coli. הנוגדנים הבאים

שימשו: נוגדן נגד LRP6 פוספוסרין 1490 (איתות תאים) בדילול 1: 1000, נוגדן נגד LRP6 (שיבוט C10, סנטה קרוז ביוטכנולוגיה) עם דילול 1: 1000, נוגדן אנטי-קטנין (שיבוט C2206, סיגמא אלדריץ ‘) עם דילול 1: 2000, נוגדן אנטי-GAPDH (שיבוט 6C5, Abcam) בדילול 1: 500, ונוגדן אנטי-GRK5 או -GRK6 (שנוצר במעבדות שלנו) בדילול 1: 1000. דיקקופף -1 נרכש מ- R ו- D מערכות. GRK5 טוהר מתאי Sf9 כמתואר (18). GRK6 ו- GSK3 מטוהרים נרכשו מ- Upstate ו- Calbiochem, בהתאמה. שניהם Wnt3A וגם המדיום המותנה בבקרה הופקו מתאי L בעכברים המבטאים יציבות Wnt3A עכברים ותאי L מסוג פרא (ATCC), בהתאמה, על פי הפרוטוקולים המתוארים ב- ATCC.

תרבית תאים, העברת DNA ואסייאת כתב לוציפראז – MEFs לדחיקת GRF6 נוצרו במעבדה שלנו מעכברי GRK6 מכהים (19). תאי HEK293 ותאי MEF נשמרו במדיום MEM ובמדיום הנשר של דולבקו שהותאם, בהתאמה, ושתי המדיות הוסיפו 10% סרום שור עוברי ו -1% פניצילין סטרפטומיצין. ביצוע transfection DNA באמצעות פוגן 6 (Roche Applied Sciences) או Lipofectamine 2000 (Invitrogen) על פי פרוטוקולי היצרנים. כדי לבצע בדיקות כתבי לוציפראז לא, הוחלפו תאים באמצעות DNA של פלסמיד הביעו את הגנים המעניינים יחד עם 0.25 גר ‘פלאש p8xTOP ו- 50 ng של שליטה פנימית פלסמיד Renilla luciferase (Promega) לבאר בצלחת עם 12 באר. מבחני הכתב בוצעו בשילוב משולש, ופעילות הלוציפראז נמדדה באמצעות ערכת ה- Dual Luciferase מבית Promega.

תרבית תאים, Transfection DNA וכתב העת Luciferase Assay GRK6 דחיקות MEFs נוצרו במעבדה שלנו מעכברי GRK6 מכהים (19). תאי HEK293 ותאי MEF נשמרו במדיום MEM ובמדיום הנשר של דולבקו , בהתאמה, ושתי המדיות הוסיפו 10% סרום שור עוברי ו -1% פניצילין סטרפטומיצין. ביצוע transfection DNA באמצעות פוגן 6 (Roche Applied Sciences) או Lipofectamine 2000 (Invitrogen) על פי פרוטוקולי היצרנים. כדי לבצע בדיקות כתבי לוציפראז לא, הוחלפו תאים באמצעות DNA של פלסמיד הביעו את הגנים המעניינים יחד עם 0.25 גר ‘פלאש p8xTOP ו- 50 ng של שליטה פנימית פלסמיד Renilla luciferase (Promega) לבאר בצלחת עם 12 באר. מבחני הכתב בוצעו בשלושה כפילות, ופעילות הלוציפראז נמדדה באמצעות ערכת ה- Dual Luciferase מבית פרומגה. טיהור חלבונים – זנב ציטוזולי LRP6 עם תווית של His6 וחלבון מוטציה M5 שלו התבטאו ב BL21DE3 pLysS (Stratagene), וטוהרו באמצעות חרוזי ניקל שרף Invitrogen ProBond על פי נוהל היצרן.

מבחני זרחן קינאז וספקטרומטריית מסה – חלבון LRP6-CT מטוהר הופעל על ידי זרחן בנוכחות ATP [32P] על ידי GRK5, GRK6, ו- GSK3 מטוהרים במאגר תגובה MOPS (20 mM MOPS pH 7.5, 10 mM MgCl2,2mM EDTA , 1 מ”מ דיאתיתריטול, ו- 60 מ”ט ATP שאינו רדיואקטיבי) ב 30 מעלות צלזיוס למשך שעה. התגובות הושבתו על ידי חיץ טעינת SDS, נפתר ב- 4-20% SDSPAGE, ואותות הזרחן כימותו על ידי זרחן. לצורך ספקטרומטריה המונית לזיהוי אתרי זרחן, בוצעו מבחני זרחן לא-רדיואקטיביים (ללא תוספת של [32P] ATP) בתנאים זהים כמתואר לעיל. הקבוצה המתאימה לחלבון LRP6-CT נותקה מג’ל SDS-PAGE, וניתוח ספקטרומטריה המונית בוצע במתקן ספקטרומטריה המונית הביולוגית (המעבדה של ד”ר סטיבן סיגי) באוניברסיטת הרווארד.

הפרעות RNA – לטרוף shRNA עדשתית (Addgene)

פלסמיד 1864) ו- shRNA lentiviral lentiviral עכברים (SHGLYCTRCN0000022829) נרכשו מ- Addgene ו- Sigma, בהתאמה. ייצור Lentivirus ו- shRNA הפילות בוצעו על פי פרוטוקולים של Addgene. עבור הורדת GRK5 באמצעות siRNA,

שני siRNAs עכברים GRK5-1, 5 -AAGGACCATAGACAGAGATTA-3; GRK5-2, 5 -AACCTGGCCTATGCCTATGAA-3) הוחלפו לתכני MEF של GRK6 מנוגדים באמצעות Lipofectamine 2000 על פי פרוטוקול היצרן. GRK5 siRNA אנושי, AAGGACCATAGACAGAGATTA; GRK6 siRNA אנושי, AACAGTAGGTTTGTAGTGAGC, שימשו להידלדלות GRK5 או רמות GRK6 בתאי HEK293, באמצעות גן משתק(ג’לנטיס).

שיבוט דג הזברה LRP6 ו- GRK5 – הזברה LRP6 (zLRP6) היה מוגבר על ידי PCR מ- cDNA של עוברים (שלב 12-סומיות) באמצעות הפריימרים הבאים: zLRP6-Forward 5 -CACCATGTATTGGACCGACTGGG-3 ו- zLRP6-Reverse 5 -TGAGGAGTCTGTGCAGGG-3. רצפים מעלה לפני ההתחלה קודון התקבלו מהגרסה הנוכחית של הגנום של דג הזברה ואומתו על ידי PCR באמצעות פולימראז והגהה גבוהה של אמינות גבוהה. כדי להשיג את רצף הקידוד השלם עבור GRK5 דג הזברה (zGRK5), זוהה רצף עם הומולוגיה משמעותית ל- GRK5 של היונקים על ידי חיפוש BLAST בבסיס הגנום של הזברה . רצף חלקי הושג על ידי PCR מ- cDNA שנוצר מעוברים לאחר הפריה (hpf) 24 שעות באמצעות הפריימרים הבאים: zGRK5-Forward 5 -AGCTCTCGAGATGGCAGCGAACTGTGCA-3 ו- zGRK5-Reverse 5

-AGCTCCGCGGGGTTAAAATGTCTCCTTACGCGTCT-3. בוצעו 5 – PCRs ו- 3 -RACE (בחירה ראשונה RLM RACE, Ambion) כדי להשיג את רצף הקידוד באורך מלא ו- 5 -UTR. CDNA באורך מלא של zGRK5 משובט לווקטור pCS2 ואילו zLRP6 משובט ל- pcDNA3.1 באמצעות מערכת השיבוט הכיווני TOPO (Invitrogen)

כדי לתמלל mRNA מכוסה במבחנה לניסויי הצלה. מוטגנזה של שיבוטים באורך מלא באתר הכריכה מורפולינו (MO) בוצעה באמצעות ערכת המוטגנזיס המכוונת לאתר QuikChange Lightning (Stratagene). רצפים עבור zLRP6 (GQ903573) ו- zGRK5 (GQ903574) הופקדו ב- GenBankTM

הזרקת מיקרו ומיקרוסקופיה – כל מורפולינו-אנטיסנס תוכננו וסונתזו על ידי GeneTools, LLC (אורגון) על סמך רצפים שהוגשו. מומסים מומסים הומסו במים מזוקקים כפולים לריכוזים סופיים של 200–500 מ ‘. פניול אדום נוספה לפתרונות להמחשה טובה יותר במהלך ההזרקה. כ -3 נ”ל של MO מדולל הוזרקו בשלב התא התא באמצעות מיקרו מזרק Eppendorf. רצפי הסדרה

מועדי המחקר הם כדלקמן: zLRP6 MO1: 5-GATTGCTGCCATCCATTCCGGCCCT-3, zLRP6 MO2: 5 -TCTCTATTCTTGGCTCCTCCCCCCA-3, zLRP6 5 חוסר התאמה בין נוקליאוטיד

מו (zLRP6 CTRL MO): 5 -TTGAGATGTATAGACTCACTGTTGG-3, zGRK5 MO1: 5 -TCGCTGCCATTGTTTCGATCTCCAT-3, zGRK5 MO2: 5-GCTAAAAATCAGCCAAGAAATGTGC-3 5 MOK 5 -TCGGTGCGATTCTTTCCATCTGCAT-3. לצורך ניסויי הצלה הוזרקו 10 חלוקות (zLRP6) ו- 100 pg (zGRK5) של mRNA לכל ביצה לחלמון. לאחר הזרקת מיקרו, עוברים הצטלמו באמצעות  מיקרוסקופ ניתוק MZ16 מצויד במצלמת monocamera בעלת 4 מגה פיקסל ותוכנת OpenLab. המדידות בוצעו ב- OpenLab, וניתוח סטטיסטי בוצע בפריזמה (תוכנת GraphPad).

כתמים מערביים והכלאה במצב עוברים של עוברי זברה – ליזיטים של עוברי 12 ש ‘שימשו לכתמים מערביים.

לצורך הכלאה במקום, כלאות הכלאה במקום באתר בוצעו בטכניקות סטנדרטיות לאחר קיבוע PFA בשלבים שצוינו (20). לצורך איתור zGRK5 ו- zLRP6, נעשה שימוש בשתי קבוצות של בדיקות אנטי-סנס-RNA שאינן חופפות ב- DIG באתרם. לניתוח של גנים חסרי תגובה, נוצרו בדיקות במקום מהפלסמידים הבאים: קטע 811-bp הוגבר מ- 24 hpf cDNA באמצעות פריימרים (Forward Axin2: 5-GCCTAAAAGCAAGGAGCAGAT, ו- Reverse Axin2: 5 -AAACTCATCACTGGCCCTTTT) rerio axin2 (NM_131561), ושכפול משנה ל- pCRII באמצעות שיבוט TOPO TA (Invitrogen). הבדיקה באתרו ל- cdx4 הוכנה מפלסמיד

התקבל ממרכז המשאבים הבינלאומי של זברה, שיבוט cb546. כדי ליצור בדיקה באתרו לאוורור, הוגבר מקטע 407-bp של מספר ההצטרפות NM_131700 באמצעות ספריית cDNA של 6 עוברי דג הזברה mRNA באמצעות הפריימרים הבאים: פורוורד קדימה 5 -TACCCAGCAAGTTCTCAGTGG, והיפוך פתח 5 -AAAAACAGCGGGATAGAGA על ידי שיבוט TOPO TA.

תוצאות

GRK5 ו- GRK6 הגבירו איתות Wnt מתווך LRP6 – השתמשנו בכתב ה- Luciferase TOPflash (LEF / TCF) כדי להעריך את פעילות מסלול ה- Wnt המווסתת על ידי GRK5 ו- GRK6. כבקרה חיובית, ביטוי יתר של enten Wnt1 או LRP6 עורר את פעילות כתבי ה- TOPflash בתאי HEK293 (איור 1 א). לעירוי של GRK5 מסוג פראי, מוטציה שמתה קינינאית של GRK5 (GRK5KD, GRK5 K215R מוטציה), או GRK6 לא הייתה שום השפעה על שיפור פעילות ה- Luciferase TOPflash (איור 1A). עם זאת, ביטוי משותף של GRK5 או GRK6 עם LRP6 עורר במידה רבה את פעילות ה- TOPflash luciferase עם עלייה ממוצעת של פי 4. על פני זו של LRP6 שבאה לידי ביטוי בלבד, ואילו GRK5KD לא שיפרה את פעילות ה- TOPflash luciferase של ה- LRP6 בתיווך (איור 1 א). כדי לאשר ש- LRP6 מעורב באופן ספציפי באיתות GRK5 ו- GRK6 בתיווך Wnt, השתמשנו ב- Dickkopf-1 (DKK1), אנטגוניסט LRP6 כדי לעכב את פעילות LRP6 (21, 22). כמוצג באיור 1B, DKK 1 עיכב את ה- Luciferase TOPflash פעילות מגורה על ידי ביטוי משותף של GRK5 או GRK6 עם LRP6, כמו גם פעילות של LRP6 בלבד (איור 1B). אלה נתונים מראים כי GRK5 ו- GRK6 מווסתים איתות Wnt קנוני באופן תלוי בפעילות קינאזית המחייב גם LRP6.

GRK5 ו- GRK6 פוספורילט LRP6 במוטיבים PPPSP במבחנה ויטרו – כדי להדגים זרחן LRP6 על ידי GRK5 ו- GRK6, טיהרנו את הזנב הציטופלסמטי LRP6 (LRP6-CT) מ- E. coli. ה- LRP6-CT המטוהר הודגר באמצעות GRK5, GRK6 או GSK3 מטוהרים כבקרה בתנאי זרחן. כפי שמוצג באיור 2A, GRK5 (מסלול 2) היה קינאז יעיל יותר ב- LRP6-CT בהשוואה ל- GSK3 (מסלול 3), והסטוכיומטריה של זרחן LRP6-CT על ידי GRK5 ו- GSK3 היו 1.2 ו -0.3 פוספט / מולקולה. בתנאים זהים (יחס המולאריות קינאז / מצע הוא 1: 5), בהתאמה. גם זרחן GRK5 וגם זרחן מתווך GSK3 הביאו לפס ניידות איטי נוסף של LRP6-CT (נתיבים 2 ו -3, לוח מכתים Coomassie Blue). לעומת זאת זרחן של חלבון מוטרי LRP6-CT (LRP6-CT M5), בו כל שאריות הסרין והתראונין

בתוך חמשת מוטיבי ה- PPPSP הוחלפו באלנין, נפגע באופן ניכר (ירידה של כ- 50%) בנוכחות GRK5 (השווה בין נתיבים 2 ו -5) או בוטל בנוכחות GSK3 (השווה בין נתיבים 3 ו -6). בנוסף, זרחן של LRP6-CT על ידי GSK3 עוצר על ידי מעכב GSK3 TWS119 (23), שגם עיכב חלקית את פעילות GRK5 בניסויים שלנו (איור S1 משלים). לפיכך, מוטיבי PPPSP מסוג GRK5 ו- GSK3 זרחן של LRP6-CT מסיסים באופן דומה, אך נראה כי GRK5 הוא הקינאז היעיל יותר. התצפית הרומנטית כי מעכב ה- GSK3 TWS119 מעכב גם ל- GRK5, יחד עם התצפית שלנו על הדמיון התפקודי בין GSK3 ו- GRK5 לפוספורילציה של אותם מוטיבי PPPSP ב- LRP6, מדגיש עוד יותר את הפוטנציאל לשיתוף פעולה הדוק בין שני קינאזים במסלול Wnt. בדומה ל- GRK5, GRK6 הצליח גם להזרים את ה- LRP6-CT מטוהרים במבחנה, והזרחן הזה פארילציה את כל חמשת מוטיבי ה- PPPSP ב- LRP6-CT, כולל שאריות סרין 1490 הנלמדות היטב שנמצאו במוטיב ה- PPPSP הראשון (איור 2, B ו- C). בנוסף לפוספורילציה במוטיבים PPPSP, שריפים 1450 וסרין 1509 מחוץ למוטיבים PPPSP זומנו גם על ידי GRK5. תוצאות אלה מסכימות עם תצפיתנו כי ניתן עדיין להזמין את המוטציה LRP6-CT M5 עם מוטיבי PPPSP בלתי ניתנים להזרמה על ידי GRK5. באופן דומה, GRK6 זרחה שלושה מוטיבים PPPSP, כולל הראשון שבהם מכיל סרין 1490, כמו גם סרין 1448 וסרין 1509 מחוץ למוטיבים אלה (איור 2, B ו- C). GSK3 זרחן ארבעה מוטיבים PPPSP, שאחד מהם מכיל סרין 1490, כמו גם סרין 1509 (איור 2, B ו- C). נתונים אלה מראים כי GRK5 ו- GRK6 מסוגלים לכוון ישירות את ה- LRP6-CT המסיס במוטיבים PPPSP במבחנה, בדיוק כמו ש- GSK3 עושה. מלבד מוטיבי ה- PPPSP, הנתונים האלה כמו כן מצביעים על כך שסרין 1509 הוא אתר נפוץ חדש שיכול להיות זרחן על ידי שלושת הקינאזות הללו GRK5 ו- GRK6 זרחן LRP6 בצלולו – כדי לבדוק אם

GRK5 ו- GRK6 זרחן LRP6 בתאים, GRK5 או GRK6 התבטאו יחד עם LRP6 בתאי HEK293. זרחן של LRP6 הוערך באמצעות נוגדן זרחן 1490 (pSer1490). ביטוי של GRK5 או GRK6 הוביל לעלייה פי 4 עד 5 של זרחן 1490 בסרין (איור 3 א), ואילו ביטוי GRK5KD או GRK2, בן נוסף במשפחת GRK המובחן מבחינה מבנית ותפקודית מ GRK5 ו- GRK6 (12– 14), השפעה מועטה או שלא הייתה (איור 3 א). הגדלת כמות ה- GRK5 המובעת בתאים הובילה לעלייה פרופורציונאלית של זרחן LRP6 (איור 3 B).

נתוני GRF5 מזהים את הנתונים GRK5 במבחנה במבחני זרחן תאיים ו- GRK6 כקינאזות הקשורים לקרום שיכולים באופן ישיר וספציפי לפוספורילציה של LRP6 במוטיבים PPPSP בשלב הבא בדקנו האם מוטיבי ה- PPPSP חשובים מבחינה תפקודית להפעלת LRP6 בתיווך GRK5 ו- GRK6. ייצרנו את המוטאנט LRP6 M5 באורך מלא, בו שאריות סרין / תראונין בכל מוטיבי ה- PPPSP הוחלפו באלנין.

בניגוד לפעילות המעוררת GRK5 ו- GRK6 של LRP6 מסוג wild-type, המוטנט LRP6 M5 לא הצליח להגיב לביטוי GRK5 או GRK6 (איור 3C) על ידי פעילות כתבת TOPflash מוגברת, מה שמצביע על כך שמוטיבים PPPSP הם הכרחיים עבור GRK5- ו- GRK6 הפעלה LRP6 מתווכת.

GRK5 / 6 נדרש לפוספורילציה עם גירוי Wnt3A של LRP6 אנדוגני – גירוי Wnt3A יכול להוביל לזרחן LRP6 במוטיבים PPPSP (9). לאחר מכן חקרנו האם GRK5 / 6 היה הכרחי לזרחת LRP6 מעוררת Wnt3A. כדי לזהות זרחן כזה של LRP6 אנדוגני (24), נוצר קו תאי עכברתי מסוג GRK6 פיברובלסט עכבר (MEF) (איור S2A משלים) ומשמש כדי לבדוק האם GRK5 היה נדרש לזרחת אנדוגני LRP6 אנדוגני WR3. ב- MEFs דחיקות GRK6, הפרעות RNA (RNAi), כולל שניהם של שני שרירים GRK5 לנטיבירליים (RNA סיכת ראש קטנה) (איור משלים S2B) ו- GRK5 siRNA (RNA המפריע קטן) (איור S3A משלים), הועסקה במיוחד כדי לדפוק- ביטוי GRK5 אנדוגני למטה. יעילות ההפחתה של RNAi אושרה על ידי כתמים מערביים באמצעות נוגדנים נגד GRK5 תאנים. S2B ו- S3A). ב- MEFs מסוג GRK6-knock-out שנדבקו בשליטה shRNA של lentiviral או הוחלפו באמצעות שליטה siRNA , טיפול Wnt3A עורר זרחון 1490 של סרין על LRP6 אנדוגני (איור 3D ותמונה איור S3,B ו- C). דחיקת GRK5 עם shRNA GRK5 עדשתית או GRK5 siRNA הפחיתו בצורה ניכרת את ה- WNT3A המעורר סרין 1490 זרחן (איור 3D ותמונות S3, B ו- C משלימות), מה שמצביע על כך ש- GRK5 ממלא תפקיד חשוב בוויסות זרחן LRP6 מגורר Wnt3A.

GRK5 מווסת איתות Wnt בדג הזברה, באופן מקביל ל- LRP6 – פנינו למודל שלם של בעלי חיים, דג הזברה, כדי להעריך את הרלוונטיות הפיזיולוגית של זרחן LRP6 על ידי GRK5 / 6. שיבטנו את ההומולוגים של דג הזברה של GRK5 ו- LRP6 של יונקים (zGRK5 ו- zLRP6) וביצענו הכלאה במקום במספר שלבים התפתחותיים, ומצאנו דפוס ביטוי חופף של zGRK5 ו- zLRP6 (איור משלים S4, A-F). במהלך somitogenesis, zGRK5 ו- zLRP6 באים לידי ביטוי בכל מקום (איור משלים S4, Aand D). בשלבים מאוחרים יותר, הביטוי zLRP6 מוגבל לדיאנספלון, לטגמנטום ולמוח האחורי (איורים משלימים. S4, E ו- F). למרות שנראה כי zGRK5 בא לידי ביטוי בכל מקום במוח ב -24 כ”ס (איור משלים. S4B), יתגלה בתבנית דיסקרטית יותר במהירות 48 כ”ס, תוך חפיפה חלקית של הביטוי של zLRP6 (איור משלים. S4C).

כדי לבחון מעורבות של zGRK5 באיתות Wnt קנוני, תוכננו שני תרגומים שונים החוסמים מורפולינו אנטיסנס (MO) עבור zGRK5 ועבור zLRP6. הזרקת שני zGRK5 MO לחלמון של עוברי שלב תא חד ספציפי בביטוי חלבון zGRK5 מוסדר כלפי מטה, כפי שהוערך בכתמים מערביים, ואילו אי התאמה של 5-נוקלאוטידים (ZGRK5 CTRL) לא עשתה זאת (איור 4A). באופן דומה, הזרקה של zLRP6 MO הורידה את רמות החלבון של zLRP6 בעוברים של 12 ss (איור 4B). כדי להעריך את ההשפעה של zGRK5 על איתות קנוני וונט, ניתחנו את רמות-הקטנין בתמציות עוברים שלמות בשתי ה- 12 שניות. גילינו הורדת רמות של -קטנין במורפנטים zGRK5,

ואילו ב- CTRL המורפנטים לא השתנו רמות הקטנין (איור 4 ג). באיור 4D חזרנו על אותו ניסוי באמצעות דג הזברה שהוחדר עם zLRP6 MO כבקרה וכמודל להפחתת איתות Wnt. כצפוי, רמות-קטנין הופחתו ב lysates של עוברים שהוזרקו לתרגום החוסם את ה- ZLRP6 MO, אך לא כאשר הוזרקו לו אי התאמה של 5-נוקלאוטידים MO (zLRP6 CTRL) (איור 4D). בשני עוברים המוזרקים zGRK5 או zLRP6 MO, ניתן היה להפוך חלקית את הצטברות הקטנין על ידי הזרקה משותפת של mRNA מכוסה הנושא מוטציות שקטות במקום הקשירה של MO (איור 4, C ו- D).

בתבנית זברה שימש תעתיק האקסינ 2 כמסמך לאיתות Wnt (25, 26). כאשר ניתחנו דג זברה שהוחדר עם MOZ5- או zLRP6 MO, האזור החיובי Axin2 במוח התפשט באופן משמעותי פחות קדמי בדגים שהוזרקו על ידי GRK5 (איור 4, F ו- F ותוספת איור S4, H ו- H) או LRP6 דגים שהוזרקו על ידי MO (איורים 4, G ו- G ותמונות משלימות איורים S4, L ו- L), בהשוואה לדגים שהוזרקו ללא CTRL או CTRL (איור 4, E ו- E, ואיור S4 משלים. , G, G, K ו- K). כפי שתמצת באיור 4H, ZGRK5 נפילה (איור 4H, סורגים 3 ו -4, לעומת סרגל 2) מחקה את הפנוטיפ של הפלה zLRP6 (איור 4H, סורגים 8 ו- 9, לעומת סרגל 7), דבר שמתורגם לירידה משמעותית בהרחבה הקדמית של ביטוי האקסינ 2 במוח המתפתח.

הזרקה משותפת של מינונים נמוכים של mRNA מכוסה הנושאת מוטציות שקטות לאתרי הכריכה של MO בהתאמה, הצילה את הפנוטיפ של MO אנטיסנס (איור 4H, פסי 5 ו -10). בהתאם לתוצאות שהתקבלו בתאים, ביטוי יתר של zGRK5 על ידי הזרקת איתות WR mRNA (איור 4H, סרגל 6), אם כי במידה פחותה ממה ש- mLNA zLRP6 עשה (איור 4H, פס 11) (ראה גם איור משלים S4, G – N)

בדקנו גם את התעתיק של גנים cdx4 (27, 28) ופרוק (29, 30), אשר שימשו גם כממצאים לאיתות Wnt בעוברי דג הזברה. בדומה להולכת אות Wnt המועשרת Websfish ב דג הזברה, הערכה הן ברמה שלאחר התרגום (מדידת הצטברות קטנין) והן ברמה התעתיקית (הערכת axin2, cdx4, ואוורור כגנים בעלי תגובה Wnt).

דיון

במחקר זה, סיפקנו הוכחות ביוכימיות ופיזיולוגיות כדי להדגים של GRK5 ו- GRK6 שביטאו באופן נרחב כי יש תפקיד בלתי צפוי וחשוב במהלך איתות Wnt כקינאזות הקשורים לממברנה עם זרחן LRP6. התפקיד הקלאסי של GRK5 ו- GRK6 הוא להזריק את ה- GPCR המופעלים על ידי זרחן, ליזום קשירת-ארסטין לריסון קולטנים, הפנמה, ואיתות (12-14). הממצאים שלנו כי GRK5 ו- GRK6  הסובל את זרחן הקולטן ממברנה בודדת LRP6 באתרי סרין / טרונין מוגדרים (כלומר סריין 1490) במוטיבים PPPSP עשירים בפרולין ובכך מפעילים את LRP6 הם חשובים ומעניינים בשני הבחינות. ראשית, תוצאה זו מרחיבה את מגוון משפחות הקולטנים, בנוסף ל- GPCRs, הניתנים לזרחן ולוויסות על ידי GRK5 ו- GRK6. יתר על כן, במקום שיש להם תפקיד מעכב כמו באיתות מתווך חלבוני G קלאסי, GRK5 ו- GRK6 עשויים להיות בעלי תפקיד מגרה באיתות Wnt / LRP6. זה מרמז כי GRK5 ו- GRK6 עשויים להיות בעלי תפקידים רחבים בהרבה מכפי שמוערכים כיום. שנית, הנתונים שלנו מספקים מנגנון חדש לפיזורילציה ולרגולציה של LRP6 בקרום הפלזמה. בעבר, הראינו ש-arrestin2 מגויס לקרום הפלזמה כדי להיקשר ל- Frizzled דרך Disheveled ובכך מווסת את פונקציית Frizzled (17). מכיוון ש- GRK- ו- -arrestins מתפקדים יחד בקווי ויסות GPCR, זה די מפתיע ש- GRK5 / 6 ו- -arrestin2 משתתפים בוויסות איתות Wnt באמצעים נפרדים, תוך תיחום הפונקציות המובחנות והעצמאיות שלהם. יהיה צורך במחקרים נוספים כדי להבהיר כיצד הפעלה הנגרמת על ידי Wnt של LRP6 מביאה לזיהוי GRK5 / 6 של הקולטן כמצע. בנוסף, הנתונים המוצגים כאן פותרים גם פרדוקס במודל הנוכחי של זרחן LRP6 על ידי GSK3 בציטופלזמה. במערכת סלולרית שכללה מוטציה GSK3 הקשורה לקרום מלאכותי, הוצע לגייס ציטוזולי GSK3 לגיוס לקרום הפלזמה דרך אקסין חלבון המתאם לפוספורילציה LRP6 במוטיבים PPPSP (11). עם זאת, על מנת שהאקסין יחבר את LRP6, ראשית יש למלא את מוטיבי ה- PPPSP, כאשר GSK3 עדיין נמצא הציטופלזמה (10, 11). לפיכך, לפחות ההתחלה של זרחן PPPSP וגם טרנסלוקציית האקסין לקרום LRP6 הייתה צפויה להיות עצמאית GSK3. הממצא שלנו כי GRK5 ו- GRK6 מתפקדים כקינאזות LRP6 מציג מכניזם פשוט להבנת זרחן והפעלה של LRP6, מכיוון שקינאזות אלה קשורות ממברנה כבר ולכן זמינות להפעלת LRP6 על ידי זרחן כדי לקדם עקירת אקסין / GSK3 לאחר מכן. בנוסף, לאחרונה הוכח כי הורמון פרתירואידי (PTH) והקולטן שלו (PTHR), GPCR הניתן לזרחן על ידי GRK5 (31), מווסת זרחן של LRP6 serine 1490 להפעלת  LRP6 באופן עצמאי ללא תלות (32) . עם זאת, הקינאז האחראי ל- LRP6 בתיווך PTH / PTHR זרחן אינו ידוע. המחקרים שלנו עשויים גם להצביע על תפקיד GRK5 ו- GRK6 בפוספורילציה LRP6 בתיווך PTH / PTHR ביחד, התוצאות שלנו מספקות תובנה חדשה על פעולות GRK5 ו- GRK6. על ידי זרחן LRP6 על מוטיבי PPPSP הם תורמים לאיתות Wnt, מסלול קריטי לתהליכים ביולוגיים בסיסיים בתאים ובמהלך ההתפתחות העוברית.

חלבונים Wnt, ויסות התפתחות באורגניזמים רבים, נקשרים לשבעה קולטני טרנסמברנפרנס (7TMS) הנקראים frizzleds, ובכך מגייסים   את המולקולה הציטופלסמית מחולקת (Dvl) לקרום הפלזמה. אנדוציטוזיס מתווך של Wg (חלבון Wnt Drosophila) ונפילות ליזוזומליות עשויות לווסת את היווצרותם של שיפועי מורפוגן. אנדיקוזיס של Frizzled 4 (Fz4) בכליות עובריות אנושיות 293 תאים היו תלויות בחלבון Wnt5A נוסף והושלם על ידי חלבון מתאם רב-פונקציונלי -ארסטין 2 (arr2), שגויס ל- Fz4 על ידי קשירה ל- Dvl2 זרחתי. ממצאים אלה מספקים מנגנון שקודם לכן לא היה מוכר לקולט גיוס של -ארסטין והדגמה כי Dvl ממלא תפקיד חשוב באנדוציטוזה של פריזלד, כמו גם בייזום איתות.מולקולות האיתות הגליקופרוטאין המופרש של משפחת Wnt (ללא כנפיים או Wg בתסיסנית) נשמרים באבולוציה וממלאים תפקידים התפתחותיים חשובים (1). פעילות Wnt מתווכת על ידי אינטראקציה עם קולטנים של 7TMS מקופלים, שמאותתים על ידי ייצוב-קטנין, ובכך משפרים את פעילותם של גורמי העתקת  LEF / Tcf. אמצעי האיתות הפרוקסימלי ביותר במסלול זה הוא מולקולה ציטופלסמטית, Dvl, המגויסת לקרום הפלזמה מאת Fz (2, 3). בתסיסנית, Wg הוא endocytosed באופן פרזל-תלוי באופן, והגביל את המרחב ההבדל בשיעורי של endocytosis Wg ושפלות lysosomal מתואמים עם היווצרות של מדרגות Wg morfogen (4). חלבוני Wnt,  הרגולטורים להתפתחות באורגניזמים רבים נקשרים לשבעה קולטנים המתפשטים (7TMS) העוסקים בטרנסממברנה, הנקראים פריזלזלים, ובכך מגייסים את המולקולה הציטופלסמית המפותלת (Dvl) לקרום הפלזמה. אנדוציטוזה מתווכת של Frigled של Wg (חלבון Wnt Drosophila) והשפלות ליזוזומלית עשויות לווסת את היווצרותם של שיפועי מורפוגן. אנדיקוזיס של Frizzled 4 (Fz4) בכליות עובריות של בני אדם 293 תאים היו תלויים בהוספה  של חלבון Wnt5A והושג על ידי החלבון המתאם הרב-תכליתי -ארסטין 2 (arr2) שגויס ל- Fz4 על ידי קשירה לפוספורילציה. Dvl2. ממצאים אלה מספקים מנגנון שאינו מוכר בעבר לגיוס הקולטנים של -ארסטין ומראים כי Dvl ממלא תפקיד חשוב באנדוציטוזה של פרזל, כמו גם בקידום איתות. מולקולות האיתות הגליקופרוטאין המופרש ממשפחת ה- Wnt (ללא כנפיים או Wg Drosophila) נשמרות בהתפתחות וממלאות תפקידים התפתחותיים חשובים (1). פעילות ה- Wnt מתווכת על ידי אינטראקציה עם קולטני ה- 7TMS הקשים, שמאותתים על ידי ייצוב-קטנין, ובכך משפרת את פעילותם של גורמי התמלול LEF / Tcf. אמצעי האיתות הפרוקסימלי ביותר במסלול זה היא מולקולה ציטופלסמית, Dvl, המגויסת לקרום הפלזמה . ארסטינים הם חלבוני מתאם רב-פונקציונליים...

295.00 

295.00 

סיוע בכתיבת עבודה מקורית ללא סיכונים מיותרים!

כנסו עכשיו! הצטרפו לאלפי סטודנטים מרוצים. מצד אחד עבודה מקורית שלכם ללא שום סיכון ומצד שני הקלה משמעותית בנטל.